Antibody Panels and Kits

121 – 135 of 1,272 results

121

MilliporeSigma™ Upstate ChIPAb+ Dimethyl-Histone H3 (Lys9) - ChIP Validated Antibody and Primer Set

Dimethyl-histone H3 (Lys9) purified antibody is made against synthetic peptide (dimethylated at Lys9) corresponding to amino acids 1-18 of histone H3

Pricing & Availability

122

Influenza A H9N2 Hemagglutinin anti-Virus, HRP, Antibody Pair, Novus Biologicals™

Antibody pair for Solid phase sandwich ELISA

Pricing & Availability
Specifications

Antigen	Influenza A H9N2 Hemagglutinin
Regulatory Status	RUO
Content And Storage	Storage of components varies. See protocol for specific instructions.
Gene Alias	HA, Hemagglutinin, Hemagglutinin HA1 chain, Hemagglutinin HA2 chain
Target Species	Virus
Conjugate	HRP
Applications	ELISA
Product Type	Antibody Pairs

123

Promotions Available

BD FoxP3 Staining Kit

High performance reagent kit for detection of human FoxP3 positive regulatory T cells

Pricing & Availability

124

Promotions Available

BD Mouse TCR V β Screening Panel

Monoclonal antibodies for T-cell receptors recognition

Pricing & Availability

125

BD Biotin Mouse CD4 T Lymphocyte Enrichment Set - DM

For negative selection of CD4 T lymphocytes from mouse spleen or lymph node

Pricing & Availability

126

Novus Biologicals™ TLR (Cell Surface) Screening Antibody Pack

For Research applications

Pricing & Availability
Specifications

Antigen	TLR (Cell Surface) Screening
Content And Storage	Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Target Species	Human,Mouse
Conjugate	Unconjugated
Applications	Western Blot,Flow Cytometry,Immunohistochemistry,Immunocytochemistry,Immunofluorescence
Immunogen	TLR1: 25 ug: WB, Flow: H, M, R: Purified TLR2: 25 ug: WB, Flow, IP, IF/ICC: H, D: Purified TLR4: 25 ug: WB, Flow, IHC: H, M, R: Purified TLR5: 25 ug: WB, Flow, IHC: H, M, D: Purified TLR6: 25 ug: Flow, IHC: H: Purified TLR10: 25 ug: Flow: H: Purified WB:Western Blot IHC:Immunohistochemistry IP:Immunoprecipitation IF/ICC:Immunofluorescence/Immunocytochemistry D:Dog H:Human M:Mouse Mk:Monkey R:Rat

127

MilliporeSigma™ RIPAb+™ hnRNPA1 RIP Validated Antibody and Primer Set

This RIPAb+ hnRNPA1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

128

MilliporeSigma™ Upstate™ Phospho-Histone H3 (Ser10)α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	P84243
Isotype	IgG
Includes	This ChIPAb+ Phospho-Histone H3 (Ser10) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Phospho-Histone H3 (Ser10)α
Regulatory Status	RUO
Gene Symbols	H3F3; H3.3B; MGC87782; MGC87783; H3.3A
Purification Method	Protein G purified
Gene ID (Entrez)	NM_003493
Formulation	Anti-phospho-Histone H3 (Ser10) (mouse monoclonal IgG, Clone CMA312). One vial containing 50μg protein G-purified antibody in 50μL PBS containing 0.05% sodium. Normal Mouse IgG. Two vials containing 25μg purified mouse IgG in 25μL storage buffer containing 0.1% sodium azide. Control Primers. One vial containing 75μL of 5μM of each primer specific for the promoter region of human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	Immunogen was a synthetic peptide corresponding to amino acids 1-19 of histone H3,phosphorylated at Ser10.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes histone H3, Mr 17kDa, phosphorylated at Ser10.

129

MilliporeSigma™ RIPAb+™ SMN RIP Validated Antibody and Primer Set

This RIPAb+ SMN -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

130

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

131

BD Biotin Mouse Dendritic Cell Enrichment Set - DM

For the negative selection of dendritic cells (DC) from mouse spleen or lymph node

Pricing & Availability

132

BD IMag™ Monocyte Enrichment Set

Optimized for used with IMagnet, and contains sufficient reagents to label 10e9 peripheral blood mononuclear cells

Pricing & Availability

133

BD Human Regulatory T Cell Sorting Kit

Provides reagents that allow investigators to stain viable human peripheral blood mononuclear cells (PBMC)

Pricing & Availability

134

MilliporeSigma™ Upstate™ REST, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q13127
Includes	This ChIPAb+ REST -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	REST
Regulatory Status	RUO
Gene Symbols	NRSF, XBR
Gene ID (Entrez)	NP_005603
Formulation	Anti-REST (Rabbit Polyclonal). One vial containing 100μL 1.0mg/mL purified rabbit polyclonal in buffer containing 0.014M phosphate buffer, pH 7.6, 0.175M NaCl, 0.07% sodium azide, and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, human Snap25. One vial containing 75μL of 5μM of each primer specific for human Snap25 promoter. FOR: AGA CTC CTT TGC AGA CAA TTT CCT; REV: CAA CAC AGA AGA TTT CCA CAA GTA GAC
Immunogen	The REST purified antibody is made against a GST fusion protein corresponding to amino acids 801-1097 of human REST.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes REST, MW 125kDa predicted, 200kDa observed.

135

Invitrogen™ Anti-Human Foxp3 Staining Set PE, eBioscience™

This Anti-Human Foxp3 Staining Set contains the buffers and monoclonal antibody necessary to successfully stain and identify Foxp3 cells.

Pricing & Availability

Welcome to fishersci.com

Antibody Panels and Kits

Filtered Search Results

Narrow Results

Influenza A H9N2 Hemagglutinin anti-Virus, HRP, Antibody Pair, Novus Biologicals™ Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Novus Biologicals™ TLR (Cell Surface) Screening Antibody Pack Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Influenza A H9N2 Hemagglutinin anti-Virus, HRP, Antibody Pair, Novus Biologicals™

Novus Biologicals™ TLR (Cell Surface) Screening Antibody Pack